| Primary Identifier | MGI:7567786 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Npl |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 63 (CGT) in exon 4 was targeted for change to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. This allele has an unintended 116 bp deletion of the 3' end of intron 3 and the 5' end of exon 4 (GRCm39:chr1:153411645-153411760). No transcripts are expressed from this allele. |
