| Primary Identifier | MGI:7628310 | Allele Type | Endonuclease-mediated |
| Gene | Mdm2 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 163 (AGT) in exon 8 was changed to alanine (GCT) (p.S163A) using an sgRNA (equivalent to AGGAGATCCATTAGTGAGACAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation prevents phosphorylation of the residue in the encoded peptide. |