|  Help  |  About  |  Contact Us

Allele : Mdm2<em1Stnj> transformed mouse 3T3 cell double minute 2; endonuclease-mediated mutation 1, Stephen N Jones

Primary Identifier  MGI:7628310 Allele Type  Endonuclease-mediated
Gene  Mdm2 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 163 (AGT) in exon 8 was changed to alanine (GCT) (p.S163A) using an sgRNA (equivalent to AGGAGATCCATTAGTGAGACAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation prevents phosphorylation of the residue in the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Mdm2<S163A>,
  • Mdm2<S163A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele