| Primary Identifier | MGI:7567398 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mybpc3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single G nucleotide was inserted/duplicated in exon 24 (ENSMUST00000111430:c.2382dupG, GRCm39:chr2:90961782dupG) using an sgRNA (targeting GGACTCCTGCACTGTGCAGTGGG) and an ssODN template with CRISPR/Cas9 technology. No protein expression was found from this allele in the left heart ventricle. The mutation creates a novel splice donor site (G-GT) the middle of the exon, the use of which leads to anomalous splicing, frameshift and premature stop codon; if the splice site is not used, the mutation will also create a frameshift and premature stop codon. It is the equivalent of a human c.2373insG (c.2373dupG) mutation associated with hypertrophic cardiomyopathy (HCM). |
