|  Help  |  About  |  Contact Us

Allele : Mybpc3<em1Dwdk> myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Diederik W D Kuster

Primary Identifier  MGI:7567398 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mybpc3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A single G nucleotide was inserted/duplicated in exon 24 (ENSMUST00000111430:c.2382dupG, GRCm39:chr2:90961782dupG) using an sgRNA (targeting GGACTCCTGCACTGTGCAGTGGG) and an ssODN template with CRISPR/Cas9 technology. No protein expression was found from this allele in the left heart ventricle. The mutation creates a novel splice donor site (G-GT) the middle of the exon, the use of which leads to anomalous splicing, frameshift and premature stop codon; if the splice site is not used, the mutation will also create a frameshift and premature stop codon. It is the equivalent of a human c.2373insG (c.2373dupG) mutation associated with hypertrophic cardiomyopathy (HCM).
  • mutations:
  • Insertion
  • synonyms:
  • MYBPC3<2373insG>,
  • MYBPC3<2373insG>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele