| Primary Identifier | MGI:7550372 | Allele Type | Endonuclease-mediated |
| Gene | Mlkl | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing is used to insert serine to alanine amino acid substitutions at codons 345 and 347 (S345A TCC to GCC, S347A AGC to GCC) in exon 8. Mlkl transcript Mlkl-201 (ENSMUSG00000012519) was used as reference for the exon number and guide sequences. crRNA (AAACACAGAAUUCCAUCAGCGUUUUAGAGCUAUGCUGUUUUG), cas9 endonuclease and a single strain oligo template (tttcaacgtctgcatctaacacatctgtctgtctagCTTGCAGGATTTGAGTTAAGCAAAACACAGAATGCCAT CGCCCGAACAGCAAAGAGCACTAAAGCAGAGAGATCCAGTTCAACG) are used. The substitutions block RIPK3 phosphorylation events blocking necroptotic cell death. |
