|  Help  |  About  |  Contact Us

Allele : Irx1<em1Tcp> Iroquois homeobox 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7565726 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, No functional change Gene  Irx1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein with guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) and a plasmid repair template targeted by a single guide RNA with the protospacer sequence GGCGAGGGCGATGCCACCTA in the plasmid backbone. The resultant allele is a loxP-flanked exon 2 with loxP sites inserted after Chr13:72108521 and Chr13: 72107212 (GRCm39).
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories