| Primary Identifier | MGI:7565726 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Irx1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein with guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) and a plasmid repair template targeted by a single guide RNA with the protospacer sequence GGCGAGGGCGATGCCACCTA in the plasmid backbone. The resultant allele is a loxP-flanked exon 2 with loxP sites inserted after Chr13:72108521 and Chr13: 72107212 (GRCm39). |