|  Help  |  About  |  Contact Us

Allele : Irx1<em2Tcp> Iroquois homeobox 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:7565727 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Irx1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) resulting in deletion of Chr13:72107210-72108528 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories