| Primary Identifier | MGI:7565727 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Irx1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and guide RNAs with spacer sequences of UGGUGAAUCAAGUGCCCCCA targeting the 5' side and UCCAAGGGCUUGUUCCACGG targeting the 3' side of exon 2 (ENMUSE00000487192) resulting in deletion of Chr13:72107210-72108528 (GRCm38). |
