|  Help  |  About  |  Contact Us

Allele : Smpd1<em1Tcp> sphingomyelin phosphodiesterase 1, acid lysosomal; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7565732 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag Gene  Smpd1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele from project TCPR0530 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence CTCTGTGGTGGGGCATTGCC and a single-strand oligonucleotde encoding a 3xFLAG tag followed by a flexible linker (GGGGS). The 3xFLAG-linker was inserted adjacent to the ATG codon of Smpd14 after Chr7:105554534.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories