| Primary Identifier | MGI:7560666 | Allele Type | Endonuclease-mediated |
| Attribute String | Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A guide RNA [ACTCCAGTCTTTCTAGAAGA] is selected to introduce a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), disrupted green fluorescent protein (GFP) sequence, a T2A peptide sequence, a frame-shifted mCherry (red fluorescent) sequence and a PolyA signal, into the Gt(ROSA)26Sor locus. Gt(ROSA)26Sor transcript Gt(ROSA)26Sor-205 (ENSMUST00000242415.1) was used as reference for the exon number and the guide sequences. |