|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(CAG-GFP*,-mCherry*)Jwtt> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Jonathan Watts

Primary Identifier  MGI:7560666 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A guide RNA [ACTCCAGTCTTTCTAGAAGA] is selected to introduce a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), disrupted green fluorescent protein (GFP) sequence, a T2A peptide sequence, a frame-shifted mCherry (red fluorescent) sequence and a PolyA signal, into the Gt(ROSA)26Sor locus. Gt(ROSA)26Sor transcript Gt(ROSA)26Sor-205 (ENSMUST00000242415.1) was used as reference for the exon number and the guide sequences.
  • mutations:
  • Insertion
  • synonyms:
  • TLR-MCV1,
  • TLR-MCV1
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories