|  Help  |  About  |  Contact Us

Allele : Slc39a8<em1Xijl> solute carrier family 39 (metal ion transporter), member 8; endonuclease-mediated mutation 1, Xiong-Jian Luo

Primary Identifier  MGI:7572529 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Slc39a8
Is Recombinase  false Is Wild Type  false
molecularNote  Alanine codon 393 (GCT) in exon 7 was changed to threonine (ACT) (p.A393T) using an sgRNA (targeting CCCAATATTATATTTGCACTCGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of human SNP rs13107325 (GRCh38:chr4:102267552C>T, c.1171G>A, p.A391T) associated with schizophrenia.
  • mutations:
  • Single point mutation
  • synonyms:
  • SLC39A8-p.393T,
  • SLC39A8-p.393T
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories