| Primary Identifier | MGI:7568003 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Astl |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Leucine codon 184 (CTC) in exon 6 was changed to histidine (CAC) (c.551T>A, p.L184H) using an sgRNA (targeting GTACGTGCATGAGCTCATGTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility. |
