|  Help  |  About  |  Contact Us

Allele : Astl<em1Lwa> astacin like metalloendopeptidase; endonuclease-mediated mutation 1, Lei Wang

Primary Identifier  MGI:7568003 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Astl
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Leucine codon 184 (CTC) in exon 6 was changed to histidine (CAC) (c.551T>A, p.L184H) using an sgRNA (targeting GTACGTGCATGAGCTCATGTAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility.
  • mutations:
  • Single point mutation
  • synonyms:
  • Astl<L184H>,
  • Astl<L184H>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele