| Primary Identifier | MGI:7568004 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Astl |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Histidine codon 186 (CAC) in exon 6 was changed to leucine (CTA) (c.557_558delACinsTA, p.H186L) using an sgRNA (targeting GAGCTCATGCACGTACTTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility. |
