| Primary Identifier | MGI:7562041 | Allele Type | Endonuclease-mediated |
| Gene | Rbck1 | Strain of Origin | C57BL/6NTac |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Cysteine codon 458 (TGT) in exon 12 (in ENSMUST00000028964) was changed to serine (AGC) (p.C458S) using an sgRNA (targeting AGAAGAAGGACGGCTGTGACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation creates an E3 ligase-inactive form of the encoded peptide. |
