|  Help  |  About  |  Contact Us

Allele : Rnase4<em1(IMPC)J> ribonuclease, RNase A family 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7562150 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rnase4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGAGAAAG and GTATTTGACCAGAATGTATA, which resulted in a 1570 bp deletion beginning at Chromosome 14 position 51,104,659 bp and ending after 51,106,228 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001429614 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor start site and termination site and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele