| Primary Identifier | MGI:7562150 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rnase4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGAGAAAG and GTATTTGACCAGAATGTATA, which resulted in a 1570 bp deletion beginning at Chromosome 14 position 51,104,659 bp and ending after 51,106,228 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001429614 (exon 2) and 229 bp of flanking intronic sequence including the splice acceptor start site and termination site and is predicted to result in a null allele. |
