| Primary Identifier | MGI:7571352 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Cryab |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 123 (CGG) in exon 3 was changed to tryptophan (TGG) (p.R123W) using an sgRNA (targeting CCGGATCCCAGCCGATGTGGATC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation associated with hypertrophic cardiomyopathy (HCM). |
