|  Help  |  About  |  Contact Us

Allele : Cryab<em1Mtc> crystallin, alpha B; endonuclease-mediated mutation 1, Michael T Chin

Primary Identifier  MGI:7571352 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Cryab
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 123 (CGG) in exon 3 was changed to tryptophan (TGG) (p.R123W) using an sgRNA (targeting CCGGATCCCAGCCGATGTGGATC) and an ssODN template with CRISPR/Cas9 technology. The mutation represents the same human mutation associated with hypertrophic cardiomyopathy (HCM).
  • mutations:
  • Single point mutation
  • synonyms:
  • Cryab<R123W>,
  • Cryab<R123W>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories