|  Help  |  About  |  Contact Us

Allele : Mybpc3<em1Mtc> myosin binding protein C, cardiac; endonuclease-mediated mutation 1, Michael T Chin

Primary Identifier  MGI:7571382 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mybpc3
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Tyrosine codon 845 (TAT) in exon 25 was changed to a stop codon (TAA) (ENSMUSP00000107058:p.Y845*) using an sgRNA (targeting CCTATGAGATGCGAGTCTACGCA) and an ssODN template with CRISPR/Cas9 technology.
  • mutations:
  • Single point mutation
  • synonyms:
  • Mybpc3<Trunc>,
  • Mybpc3<Y838X>,
  • Mybpc3<Y838X>,
  • Mybpc3<Trunc>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories