|  Help  |  About  |  Contact Us

Allele : Zc3h12a<em1Aki> zinc finger CCCH type containing 12A; endonuclease-mediated mutation 1, Shizuo Akira

Primary Identifier  MGI:7562019 Allele Type  Endonuclease-mediated
Gene  Zc3h12a Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 513 (TCT) in exon 6 was changed to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the affected residue in the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Regnase-1<S513A>,
  • Regnase-1<S513A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories