| Primary Identifier | MGI:7562019 | Allele Type | Endonuclease-mediated |
| Gene | Zc3h12a | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 513 (TCT) in exon 6 was changed to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the affected residue in the encoded peptide. |
