|  Help  |  About  |  Contact Us

Allele : Zc3h12a<em2Aki> zinc finger CCCH type containing 12A; endonuclease-mediated mutation 2, Shizuo Akira

Primary Identifier  MGI:7562028 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zc3h12a
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Serine codon 513 (TCT) in exon 6 was targeted for change to alanine (GCT) (p.S513A) using sgRNAs (targeting GTGGGTGGGGGTAATGGGTA and CCTACCCATCCAGAGTAC) and an ssODN template with CRISPR/Cas9 technology. This allele represents an untargeted 1 bp deletion (one of 3 Cs (G on forward strand) at GRCm39:chr4:125013313-125013315) that leads to a frameshift and premature stop codon (p.P517Hfs*50). Expressed peptides lack the C terminal domain (CTD) and part of the proline-rich region.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Regnase-1<deltaCTD>,
  • Regnase-1<deltaCTD>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories