|  Help  |  About  |  Contact Us

Allele : Sqstm1<em1Kmts> sequestosome 1; endonuclease-mediated mutation 1, Masaaki Komatsu

Primary Identifier  MGI:7570167 Allele Type  Endonuclease-mediated
Attribute String  Constitutively active Gene  Sqstm1
Transmission  Not Specified Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 351 (TCT) was changed to glutamic acid (GAG) (p.S351E) using a pegRNA (containing target-binding sequence GACUGGAGUUCACCUGUAGA and template GUGGACCCAGAG) with the prime editing system. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphomimetic, rendering the peptide permanently activated.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • p62<S351E>,
  • p62<S351E>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories