| Primary Identifier | MGI:7570167 | Allele Type | Endonuclease-mediated |
| Attribute String | Constitutively active | Gene | Sqstm1 |
| Transmission | Not Specified | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 351 (TCT) was changed to glutamic acid (GAG) (p.S351E) using a pegRNA (containing target-binding sequence GACUGGAGUUCACCUGUAGA and template GUGGACCCAGAG) with the prime editing system. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphomimetic, rendering the peptide permanently activated. |
