| Primary Identifier | MGI:7606828 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag | Gene | Cbx2 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Two tandem HA epitopes were inserted in-frame into the N terminus of the endogenous Cbx2 locus. The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS). |
