|  Help  |  About  |  Contact Us

Allele : Cbx2<em3Rek> chromobox 2; endonuclease-mediated mutation 3, Robert E Kingston

Primary Identifier  MGI:7606828 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag Gene  Cbx2
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Two tandem HA epitopes were inserted in-frame into the N terminus of the endogenous Cbx2 locus. The following 63-bp sequence was knocked in right after the ATG start codon: TATCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCC (inserted right after position chr11:119023111, mm10). One Gly linker (underlined) was placed between HA sequences, and one GlySer linker (underlined) was placed between the 2xHA and CBX2 proteins (YPYDVPDYAGYPYDVPDYAGS).
  • mutations:
  • Insertion
  • synonyms:
  • Cbx2<HA>,
  • Cbx2<HA>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories