| Primary Identifier | MGI:7608098 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Crlf3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Leucine codon 389 (CTA) in exon 8 was changed to proline (CCA) (c.1166T>C:p.L389P) using sgRNAs (targeting GGAACTTCTAACAGCCATGA and GATATCGAAGCTGTGACTCT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with higher autism burden in neurofibromatosis type 1 (NF1) patients. |
