| Primary Identifier | MGI:7577005 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ppp6r1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CATAGAACATAATCTGAAGG and CATCCAGCATTAGGCTCAGG. This resulted in a 692 bp deletion of Chr7:4,642,957-4,643,648(GRCm38/mm10) that removes exons ENSMUSE00000415805, ENSMUSE00000415802, and ENSMUSE00000415797. |