|  Help  |  About  |  Contact Us

Allele : Ppp6r1<em1(IMPC)J> protein phosphatase 6, regulatory subunit 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7577005 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ppp6r1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CATAGAACATAATCTGAAGG and CATCCAGCATTAGGCTCAGG. This resulted in a 692 bp deletion of Chr7:4,642,957-4,643,648(GRCm38/mm10) that removes exons ENSMUSE00000415805, ENSMUSE00000415802, and ENSMUSE00000415797.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories