|  Help  |  About  |  Contact Us

Allele : Tmem185b<em1(IMPC)J> transmembrane protein 185B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7577007 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem185b
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAACAGGCCCCTGGGGTTCA and TGGCATATCAATGTTTAACT. This resulted in a 1,036 bp deletion of Chr1:119,526,512-119,527,547 (GRCm38/mm10) that removes exon ENSMUSE00001316241.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories