| Primary Identifier | MGI:7577007 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem185b |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GAACAGGCCCCTGGGGTTCA and TGGCATATCAATGTTTAACT. This resulted in a 1,036 bp deletion of Chr1:119,526,512-119,527,547 (GRCm38/mm10) that removes exon ENSMUSE00001316241. |