| Primary Identifier | MGI:7579050 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc17a4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAATGTCCAAAATTAGTCA and ACCTGTTTATCCAAACAACG. This resulted in a 1086 bp deletion of Chr13:23,904,591-23,905,676 (GRCm38/mm10) that removes exons ENSMUSE00000491519, ENSMUSE00000517959, and ENSMUSE00000518852. |