| Primary Identifier | MGI:7579076 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ido2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tyrosine codon 346 (TAC) in exon 10 was changed to a stop codon (TAA) (p.Y346*) using sgRNAs (targeting ATCTGGCCACGACATTGATGTGG and CAGTTACCACATCAATGTCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of common human SNP rs4503083 (p.Y359*) that creates a KO allele. No protein expression was detected in the liver. |