| Primary Identifier | MGI:7579187 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Morc2a |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 87 (TCA) in exon 6 was changed to leucine (TTA) (c.C260T, p.S87L) using sgRNAs (targeting AGTGGACTCAGGAGTTCTTTTGG and TTTTGGCTGACTTCCCAAACTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Charcot-Marie-Tooth disease type 2Z (CMT2Z) and developmental delay, impaired growth, dysmorphic facies and axonal neuropathy (DIGFAN). |
