|  Help  |  About  |  Contact Us

Allele : Chchd10<em3Dpn> coiled-coil-helix-coiled-coil-helix domain containing 10; endonuclease-mediated mutation 3, Derek P Narendra

Primary Identifier  MGI:7579274 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Chchd10
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Glycine codon 54 (GGC) was changed to arginine (AGA) (p.G54R) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTAGGG) and an ssODN templete using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.G58R mutation found in a family with mitochondrial myopathy.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • C10<G58R>,
  • C10<G58R>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories