| Primary Identifier | MGI:7579274 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Chchd10 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 54 (GGC) was changed to arginine (AGA) (p.G54R) using an sgRNA (targeting TAGCCGTGGGCTCAGCTGTAGGG) and an ssODN templete using CRISPR/Cas9 technology. The mutation is the equivalent of the human p.G58R mutation found in a family with mitochondrial myopathy. |
