|  Help  |  About  |  Contact Us

Allele : Col1a1<tm3(tetO-GFP/RNAi:Kras247)Ttam> collagen, type I, alpha 1; targeted mutation 3, Tuomas Tammela

Primary Identifier  MGI:7610035 Allele Type  Targeted
Attribute String  Inducible, Knockdown, Reporter, RMCE-ready Gene  Col1a1
Transmission  Germline Strain of Origin  (C57BL/6 x 129S4/SvJae)F1
Induced With  doxycycline/tetracycline Is Recombinase  false
Is Wild Type  false
molecularNote  The targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras (ACTTGACGATACAGCTAATTC) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras247 indicates that the position of the first base pair bound by the shRNA seed sequence is 247 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories