| Primary Identifier | MGI:7610035 | Allele Type | Targeted |
| Attribute String | Inducible, Knockdown, Reporter, RMCE-ready | Gene | Col1a1 |
| Transmission | Germline | Strain of Origin | (C57BL/6 x 129S4/SvJae)F1 |
| Induced With | doxycycline/tetracycline | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras (ACTTGACGATACAGCTAATTC) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras247 indicates that the position of the first base pair bound by the shRNA seed sequence is 247 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette. |
