| Primary Identifier | MGI:7638797 | Allele Type | Endonuclease-mediated |
| Attribute String | Constitutively active | Gene | Rabl2 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glutamine codon 80 (CAG) in exon 5 was changed to leucine (TTG) (p.Q80L) using an sgRNA (GCAUGCUCUGGAACCGCUCC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide in a GTP-locked constitutively active state. |
