|  Help  |  About  |  Contact Us

Allele : Rabl2<em1Xiuy> RAB, member RAS oncogene family-like 2; endonuclease-mediated mutation 1, Xiumin Yan

Primary Identifier  MGI:7638797 Allele Type  Endonuclease-mediated
Attribute String  Constitutively active Gene  Rabl2
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamine codon 80 (CAG) in exon 5 was changed to leucine (TTG) (p.Q80L) using an sgRNA (GCAUGCUCUGGAACCGCUCC) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded peptide in a GTP-locked constitutively active state.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Rabl2<KI>,
  • Rabl2<KI>,
  • Rabl2<Q80L>,
  • Rabl2<Q80L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele