| Primary Identifier | MGI:7621333 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mroh5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATGCTTCCACGCCTGCCCCA and CTGATAGCTTGCTTTTTACG. This resulted in a 316 bp internal deletion of Chr15:73,820,200-73,820,515 (GRCm38/mm10) that removes exon ENSMUSE00000754461 and has a 1 bp insertion. |
