| Primary Identifier | MGI:7621681 | Allele Type | Endonuclease-mediated |
| Gene | Arhgap35 | Strain of Origin | (C57BL/6 x DBA/2)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 1284 (CGG) in exon 4 was changed to alanine (GCA) (p.R1284A) using an sgRNA (equivalent to AAGCACTGAAGGCATCTACC) and an ssODN template with CRISPR/Cas9 technology. The mutation abolishes the GTPase-activating catalytic function of the encoded peptide. |