| Primary Identifier | MGI:7621841 | Allele Type | Endonuclease-mediated |
| Gene | Arhgap35 | Strain of Origin | (C57BL/6 x DBA/2)F1 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 36 (TCT) in exon 2 was changed to asparagine (AAT) (p.S36N) using an sgRNA (equivalent to AGAAAGGCCAGTGCGGCATT) and an ssODN template with CRISPR/Cas9 technology. The mutation impairs the GTP-binding function of the encoded peptide. |
