|  Help  |  About  |  Contact Us

Allele : Arhgap35<em2Slp> Rho GTPase activating protein 35; endonuclease-mediated mutation 2, Samuel L Pfaff

Primary Identifier  MGI:7621841 Allele Type  Endonuclease-mediated
Gene  Arhgap35 Strain of Origin  (C57BL/6 x DBA/2)F1
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 36 (TCT) in exon 2 was changed to asparagine (AAT) (p.S36N) using an sgRNA (equivalent to AGAAAGGCCAGTGCGGCATT) and an ssODN template with CRISPR/Cas9 technology. The mutation impairs the GTP-binding function of the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • p190<S36N>,
  • p190<S36N>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele