|  Help  |  About  |  Contact Us

Allele : Dnmt3a<em1Tcp> DNA methyltransferase 3A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7587755 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Dnmt3a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence CTCCAATCACCAGGTCGAAT and a single-strand oligonucleotide encoding the changes c.2113-2114CC>GT [p.P705A] and c.2116-2117TG>GA [p.C706D], and c.2085C>A to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUST00000020991 (GRCm39).
  • mutations:
  • Nucleotide substitutions
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

1 Publication categories