| Primary Identifier | MGI:7587755 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Dnmt3a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence CTCCAATCACCAGGTCGAAT and a single-strand oligonucleotide encoding the changes c.2113-2114CC>GT [p.P705A] and c.2116-2117TG>GA [p.C706D], and c.2085C>A to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUST00000020991 (GRCm39). |
