| Help | About | Contact Us

Allele : Fut11<em1(IMPC)J> fucosyltransferase 11; endonuclease-mediated mutation 1, Jackson

Primary Identifier	MGI:7593974	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Fut11
Inheritance Mode	Not Specified	Strain of Origin	C57BL/6NJ
Is Recombinase	false	Is Wild Type	false
Project Collection	IMPC

molecularNote

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CATGGCTGCTCGCTGTACCG and GCTCATGCGCTACATCCCGG. This resulted in a 678 bp deletion of Chr14:20,695,019-20,695,696 (GRCm38/mm10) and removes exon ENSMUSE00000234144.

mutations:
Intragenic deletion

earliestPublication:
The Jackson Laboratory (2012) Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

1 Carried By

0 Driven By

2 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76869446

MouseMine