|  Help  |  About  |  Contact Us

Allele : Apoe<em1Aduci> apolipoprotein E; endonuclease-mediated mutation 1, Frank LaFerla

Primary Identifier  MGI:7622033 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Apoe
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using CRISPR/Cas9 technology, a guide RNA (gcacagaggagatacgggcg) was designed to produce a CGG to TCT missense mutation resulting in an arginine to serine mutation (R128S) in the apolipoprotein E (Apoe) gene. The missense mutation corresponds to the human SNP rs121918393 found in human APOE mature protein and is associated with an increased risk of Alzheimer’s disease (AD).
  • mutations:
  • Nucleotide substitutions
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories