| Primary Identifier | MGI:7612576 | Allele Type | Endonuclease-mediated |
| Gene | Brcc3 | Strain of Origin | (C57BL/6 x SJL)F1/J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Glutamic acid codon 33 (GAA) in exon 1 was changed to alanine (GCA) (p.E33A) using an sgRNA (targeting AGTGATGGGTCTGTGTATAG) and an ssODN template with CRISPR/Cas9 technology. The mutation abolishes the deubiquitylating enzymatic activity of the encoded peptide. |
