|  Help  |  About  |  Contact Us

Allele : Brcc3<em1Roag> BRCA1/BRCA2-containing complex, subunit 3; endonuclease-mediated mutation 1, Roger A Greenberg

Primary Identifier  MGI:7612576 Allele Type  Endonuclease-mediated
Gene  Brcc3 Strain of Origin  (C57BL/6 x SJL)F1/J
Is Recombinase  false Is Wild Type  false
molecularNote  Glutamic acid codon 33 (GAA) in exon 1 was changed to alanine (GCA) (p.E33A) using an sgRNA (targeting AGTGATGGGTCTGTGTATAG) and an ssODN template with CRISPR/Cas9 technology. The mutation abolishes the deubiquitylating enzymatic activity of the encoded peptide.
  • mutations:
  • Single point mutation
  • synonyms:
  • Brcc36<E33A>,
  • Brcc36<E33A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories