|  Help  |  About  |  Contact Us

Allele : Cdca7<em1Ldax> cell division cycle associated 7; endonuclease-mediated mutation 1, Lucia Daxinger

Primary Identifier  MGI:7614313 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Cdca7
Strain of Origin  FVB/NJ-Tg(HBA1-GFP)1Ew/Ew Is Recombinase  false
Is Wild Type  false
molecularNote  Glycine codon 305 (GGC) in exon 7 was changed to valine (GTC) (c.914G>T;p.G305V) using an sgRNA(targeting AGGGACCACAGAATTGGCCCCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the carboxyterminal 4-CXXC–type zinc finger (ZF) domain of the encoded peptide, is the equivalent of the human c.881G>T; p.Gly294Val mutation associated with immunodeficiency, centromeric instability, facial anomalies syndrome 3 (ICF3).
  • mutations:
  • Single point mutation
  • synonyms:
  • Cdca7<G305V>,
  • Cdca7<G305V>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories