| Primary Identifier | MGI:7612356 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Acta2 |
| Strain of Origin | C57BL/6NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 149 (CGT) in exon was changed to cysteine (TGT) (p.R149C) using an sgRNA (targeting TGGACGTACAACTGGTAGGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with heritable thoracic aortic disease (HTAD). |
