| Primary Identifier | MGI:7614892 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mbtps2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Asparagine codon 455 (AAT) in exon 11 was changed to serine (AGT) (c.1364A>G:p.N455S) using an sgRNA (targeting TTGACCATCCAAGGCAAAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1376A>G (p.N459S) mutation associated with X-linked osteogenesis imperfecta (OI). |
