|  Help  |  About  |  Contact Us

Allele : Mbtps2<em1Sapo> membrane-bound transcription factor peptidase, site 2; endonuclease-mediated mutation 1, Sandra Pohl

Primary Identifier  MGI:7614892 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mbtps2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Asparagine codon 455 (AAT) in exon 11 was changed to serine (AGT) (c.1364A>G:p.N455S) using an sgRNA (targeting TTGACCATCCAAGGCAAAGC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1376A>G (p.N459S) mutation associated with X-linked osteogenesis imperfecta (OI).
  • mutations:
  • Single point mutation
  • synonyms:
  • Mbtps2<N455S>,
  • Mbtps2<N455S>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele