| Primary Identifier | MGI:7616745 | Allele Type | Endonuclease-mediated |
| Attribute String | Recombinase | Gene | Klf1 |
| Strain of Origin | C57BL/6J | Is Recombinase | true |
| Is Wild Type | false |
| molecularNote | Using CRISPR technology, sgRNA (based on ATCTTTTGGGATACGGTCCT) was designed to insert a T2A self-cleaving peptide sequence, flanked by linkers, followed by a codon improved icre sequence into the C-terminal of the Klf1 gene fused in-frame to the final leucine amino acid. |
